CShisMan2_1048


Sequence

>CShisMan2_1048 (21 EST) Length=754 ATTCTTAATATATTTATTTAAGATGAAATTAAAGCAACATTAAAAGAAAGGGGAATGCAAAGTTAATTAACATTCAAATT AATCATGCAAGTCTGTGAATAACAATCGGTAGTCCGATGACAGGCTAATTAGTTCGGGAGGTAACTCCGCCAGAATCTCG AAACCAATAAACATAAGTGTTTTCAGAAGCGGAGTGACTACTTTTGGCTCACCAGACTGCGGCTTGGGAACAGCAACATA CGCTTTGTTCACTCCACACTGTTCAAGTTCTTCCAGACATGAAACAAGTGCATTTTTTTGAAGAACCACAGGGGGCTTCG AAGCCATAGATAAAAATATTACCGCTGTTTTTGAATCGTCAATACGTGCAACAAGCAGATTTGTAGGCGGCAATGATGAT CTGGCAGCTTTCAAAAAACTGACTGTTTCAGGAGACAGATCTGGCACGTTAATCACCGAGGTGTGGGTGCTTCTGTCGCT TTCTCTTCGTATTCGACAACCTATATGCTTTTGCTGACATATCTCTGGATCACTTGTAGATAGTGAGTCAAGGGACTGTG AACTCGATGTATGTTGAGAGTCATTCGCACGCCACTGAATTCGTTCATTGTTCGAAACACTCCCGGAGTGTTGGGATAGT ATCTTTGCATCCCCCGTAGGAACATCAAATATAAGGCCGAGGCCATATGCCGAGACTCGTACGGAAATGAACAATATTTT GGATCTCAACAGTAGACATTTACCTTCGAAATTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1048: (21 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39294514688T14521SMEST0182Schistosoma mansoni, adult worm, Gloria Franco
39295514689T14522SMEST0183Schistosoma mansoni, adult worm, Gloria Franco
39310514704T14537SMEST0198Schistosoma mansoni, adult worm, Gloria Franco
39311514705T14538SMEST0199Schistosoma mansoni, adult worm, Gloria Franco
5137391444992W06772SMEST0408Schistosoma mansoni, adult worm, Gloria Franco
7824581713296AA143891MCCE0279.M1RSchistosoma mansoni, cercariae
8733161858028AA233976SMIPADA000049M13RSchistosoma mansoni adult worm Lambda ZAP II library
11529092245744AA508304MAAD0461.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
12099152330204AA559508MC280407.NA3TBRI-Saber-cercaria-A
17369963189916AA999361MCCE3201.M1FSchistosoma mansoni, cercariae
17653963241803AI026189MEEG0425.M1FSchistosoma mansoni, egg stage
18150743385434AI067467EST209149Schistosoma mansoni, Phil LoVerde/Joe Merrick
18151693385529AI067562EST209244Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156613386021AI068054EST209743Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157793386139AI068172EST209863Schistosoma mansoni, Phil LoVerde/Joe Merrick
18158583386218AI068251EST209942Schistosoma mansoni, Phil LoVerde/Joe Merrick
18158593386219AI068252EST209943Schistosoma mansoni, Phil LoVerde/Joe Merrick
18694223509823AI111135MF003G10.NK3S. mansoni, female enriched, subtractive, HHU(A)
18695313509932AI110962MF002F07.NK3S. mansoni, female enriched, subtractive, HHU(A)
18695383509939AI110969MF002E12.NK3S. mansoni, female enriched, subtractive, HHU(A)
18696323510033AI111063MF001E01.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 13:32:39 on Thu 23 Nov 117.