CShisMan2_1052


Sequence

>CShisMan2_1052 (3 EST) Length=609 GTAAACCAGCAGAAAAAGCTATCTTGTGTCTGGTCCTCAAATGTTCGTTTCTTAGCTTGATCACCACCGTTCTTTTTCGA GTTAGATGAATTGCTTGTCAGATCTTTGCCCGGATACCAGTCTATCTTGGTGAACGTGGAAGATGGTTCACCACTATCTC CTAAGTGGAACTCCTTGGTTAATACACTGTTCTTGAACCACTCATTCTTCTCGAAGTGAAAGTTAATTCGGAAACCGGAC TTAATGTCCTCAAACTCCTGAACTTCCACCTTTTTCAAATGCTTTAGTACACTTTCGTCATTGCTCGTAAGCAAGTCTGA CAACTGGGGGTGATTAATAAATGTAGTGAGCCAGAAGTTTGGGATCTTGGAAATCAGCTCACAACGTTTCTCAAAGTGAG GNTGCCTCATCTTATTGAACTTTTGTTCAACTTTTAGGATCTCTTCACTGGCTTGCTCATTGAGGTTGTNCAATGGCATT TTGAACTTCCTCTATCTCATCGATGAGAGTATTAGTCGAACTTAGTTCTCCATCAGCACCAGTATCATTACTGGGTCGAG GTACTTTAGGTTGGGTCGCCATTGCATCGATGCCGACTTGATGGATAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1052: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12100172330306AA559610MC080549.NA3TBRI-Saber-cercaria-A
13272142546878AA629470MU000100.Y2RSmL
13277682552105AA629494MU000061.Y2RSmL


Date: 19:26:12 on Sun 19 Nov 117.