CShisMan2_1053


Sequence

>CShisMan2_1053 (5 EST) Length=603 ANAGGTTTTACCTGCAACGACCGAATTTAAAATACGCCNAATAAGTTTCATAGATTATAACATACATATGTAATNAAGAT ATTTAACATTNCTCCACAATCTTCGATTATAATTTTTCTTGGACGGCTTTCCACTTGTGGAACCTAAACTCTCCATTTTC NTTCACCACGTCTATGCCACTGACGACTTTACCGAAAACAACATGTTTGCCGTCAAGCCACGAACNAGGGNCAGTAGTAA TAAAGAATTGCGAACCATTGGTGTTAGGTCCCGCATTGGCCATTGAAAGTGAGAACGCTTCGTGTTTGTGATTGAAGTTC TCATCTTTGAATTTATTTCCGTATATACTTTTTCCACCCGTGCCATCGCCATTGGTGAAATCGCCACCCTGACACATGAA GCCTGGAATTATTCGGTGGAAAACGGAACCTTTGTAACCAAAATTATTCTTGTGAGTGCATAACTCGCGAAAGTTTCTAG TAGTATCTGGAACATCATTGAATAGCTCAAATATAATCCTCCCCAATCGTTCATACACCGGCCTTAATATCGAAAAACGN TTTCGCAGCCATTTTTGAAATGGATGGTCACCACCGGTCAATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1053: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344914975970R95600SMNHADA017019SKSmAW
4071401119146H98261SMNHADA015005T3SmAW
8577911832551AA218458MAAD0115.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
8578131832573AA218480MAAD0145.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
12100892330378AA559682MC180932.NA3TBRI-Saber-cercaria-A


Date: 10:26:15 on Mon 20 Nov 117.