CShisMan2_1055


Sequence

>CShisMan2_1055 (2 EST) Length=336 ACGAACCCCCAATTATTTATTATTAAAATTGAAAAAATAAACAGCAAAAATGCATGACAAAACATAATATTGTTAACTAA TAGTCTTTAAAAAAACTTTAGTCCATAACATTAATAACAACTAACCCATTATTCATTAAGTGTGGTTACAGACTTAACTG CTTTCCATGTAAAGTTTGCCTTTGTGGAAATTGGATTACATGATTGTTGTTTCTTGGAAGGTGCAATCCATTTAAGTTGA TCAACTGAGGGTAAATCACAATGAAGGAAAGGACATTTAGTACGATTAGTGCACCCAGAACCATATCCACATGGAATTTG GCTATTGAAAACAGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1055: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18152993385659AI067692EST209375Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153903385750AI067783EST209467Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 9:0:16 on Tue 21 Nov 117.