CShisMan2_1057


Sequence

>CShisMan2_1057 (2 EST) Length=335 AAAAGAATAAAGATCCACTTAATCACAGTGTCGTTGCATTATTAGGTGATAGTAAAGATCCTTTAGTATCCAATCTATTT ACTCCAGTTGTCGGTGAACCTGGTAAAAAGACGAAAGGTGGCTCTTTCTTGACAGTGACCTACATGCACAGGGAATCATT GAATAAATTAATGAAAAATTTACAAAGTACCAGTCCATCATTTATCCGTTGTATGTCCCGAATGAATTTAAACAACCTGG TGTCATTGATGCTCATTTGGTTCTGCATCAATACATTGTAATGGTGTACTTGAAGGTATACGTATTGTCGTAAAGGTTCC AAATCGTATGATTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1057: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9100821906147AA269050MA1MA050.AA3S. mansoni adult Lambda Zap
12165652338814AA566182MA3MAR12.AA3S. mansoni adult Lambda Zap


Date: 14:23:57 on Sun 19 Nov 117.