CShisMan2_1058


Sequence

>CShisMan2_1058 (2 EST) Length=333 GGCACATCTCACGTCGGGTAGTTCCTTTCGAGTGCTGTCTGTCTGATCTAAAATGAGCAAAGCACATCAACCAGAGTTGA AAAAGTACCTTGACAAGCGTCTAAGACTGAAGCTCAACGCAAATCGAGAAGTTGTCGGTGTTTTTGCGTGGCTTTGGATG CTTTCATGAATATTGTTGTCAGTGATGCTTATGAAGTCACTAAAGATGGTAATCAGATCAAGATTGGATATGGCCGTTGG TCCGCGGCAATAGCATTAATATCGTGGAAGGCGTAGGATCGCATTTAAATGTATATATGTACTCGTTTATTTCAATAAAC CCTTTTCACTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1058: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4191611128012N21879SMNHADA019030SKSmAW
18151943385554AI067587EST209269Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 19:15:56 on Sun 19 Nov 117.