CShisMan2_1059


Sequence

>CShisMan2_1059 (2 EST) Length=339 GGTTGAAAGTAGGATTGTTCATATTCGAATACAACAACGAAATGGCCGCAAAACACTTACTACTGTCCAAAGGATACCAG AGAAGTTTGACAAGCGAAAAATCTTGAAGTACTGCAAGAAACATTTCGCGTGTAACGGTACACTAGTTGCAACATAAAAG AGTATGGGGAGGTGTTACAATTCCAAGGTGATCAGAGGGAGTAATCTGAAGTCTTTTATGTGTGAGATCGAACATAGTCA CTCCTGAGGAAGTCAAGCTGCATGGATTTTAATTGCATGTTGACATTTCAATTTTGTGGTCATTTCAAAGAGTCACTACT TCTTCAGATACTGTCTACT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1059: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12098892330178AA559482MC260492.NA3TBRI-Saber-cercaria-A
18151993385559AI067592EST209274Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 12:58:40 on Sun 19 Nov 117.