CShisMan2_106


Sequence

>CShisMan2_106 (2 EST) Length=606 CGGTCGTCAAAAGTTACTTCGGGGAGATCCAACTCGGNGATCGATGTTGAACNATCGGAATTGGAACGTTGATTTGGGAT CACACGGAATCGAACCTGGTGTCACTCTGATGTTTACAGCACAGTATCGTTCACTCTCATCTGAACTATCTGAACAATCC GATTTTCCATCACAAAATAAATTAAATGGTAAACATCGTCCATCCATACATTGAAACTGTCCACTTGGACAAGGTCTTTC AATTTCTATTACAGTAGTTCTATTTCCTAATCCAGGGAAGATACAATGAATCTGGAAAGGATGATCTCTATCCGTCAAAC CATATATTGCACTAACACGAGGACGATTCGGTGAAAGATATTCCACAATTAAAACGTGGATCTTGACTAACAAGTATACC GATAGATAATCGGGCTTCTNGGTTTATTCCAGGGACATGAGAAATACATTCAAATTCAAAAGGTTTATATGGTTGACCAT GAATAATTGCTTGGGCTGATTNCCACTTGTATAATTCGGCTACAATATGGGGGCGGTCATCTGACCATCAGGCAATCAAC TTGCCNTTACAGAATCAGTTTCTGACCGCATGTTCCNTNTTTNCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CShisMan2_106: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11826632160120L81257SCMRAP0377C2/S1 day seven schistosomula mini-library
11826642160121L81258SCMRAP0378C2/S1 day seven schistosomula mini-library


Date: 5:58:51 on Wed 22 Nov 117.