CShisMan2_1065


Sequence

>CShisMan2_1065 (6 EST) Length=521 GTAATGAACCAAAGTATGCCTTACTTGACTCTTCCTGCATACCANCGTANCTGAGTGTTTAAAGGACACTGTCTCAACGT GTACTGCCATTTTGGTTTGATACTATTTCTGCAAGGTATAAAGAGACGCGAACAGGTTCTGATTGTCGCCCATGGAAACA GTTTAAGAGCGCTTATCAAGTACTTGGATAATACATCTGATTCAGATATTGTGGAACTCAATATACCCACTGGTATTCCA CTAGTCTATGAACTGGATGCGAACTTGAAGCCAACCAAACACTATTATCTTGCCGATGAAGCGACAGTAGCAGCAGCAAT AGCACGTGTGGCGAACCAGGGAAAAAAGAAATGAAGCGAATAATTATCATTATCGATAATTTCTTCATTATTCATCCATC CATTAATATTTAACACATGTTTTGAATAATTTTAGTCATCTATAGCTTTGAGTAATGAACAGATACTCTGATCGTCCTTA CTCATAATCGTATTGTATGAAGTAAATATTTTCCTTTATAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1065: (6 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
345025981292R95632SMNHADA019061SKSmAW
5137101444963W06743SMEST0379Schistosoma mansoni, adult worm, Gloria Franco
11826172160074L81211SCMRAP0310ENR2/ENR2 three hour schistosomula worm
11826322160089L81226SCMRAP0325ENR2/ENR2 three hour schistosomula worm
17369273189847AA999292MCCE3104.M1FSchistosoma mansoni, cercariae
17370223189942AA999387MCCE3231.M1FSchistosoma mansoni, cercariae


Date: 11:35:5 on Fri 24 Nov 117.