CShisMan2_1067


Sequence

>CShisMan2_1067 (2 EST) Length=337 TATAAGTATTATATNAGGGTGGTGTATATTTATAGNTTACGATGTCTGTTCGGAAGCTTCGTCATCTTTATCTTGAGTAT GTCTGTTTATTTGAAGATTTGGCGGTTTGTTGCATTTATTCNTTATAGGTGGGTGGTTAACGTGTCTTATCCTTTGGTAT GTCTTTATTATGGGTATATAGAACTGTAGGTGGAGGTATAAAGAATTCTATACGTTCTCGTTTGNCAGTATTATAATAAT TACAGGTTGGATTTAGGTCCATTATATCGTCCGTTATATTTTAGCCTATTCNCATCGGGTTGTCTCTTTAGCATCATAAG CGTATAGGGTTATTATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CShisMan2_1067: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4350031154027N33628SMNHADA002012SKSmAW
16891403116509AA952803SMTBCEA000172SKSchistosoma Lambda Zap II cercariae


Date: 21:0:24 on Wed 22 Nov 117.