CShisMan2_107


Sequence

>CShisMan2_107 (3 EST) Length=611 CCGCATGTTGAAGTAACGACGAATTTGACGCTTAAACTCCGACAAATATTTCCATACTCCACGCATAGGTCCTCAGACCC CTGGCTTAGCACTACTACGCTAAACTTCCTAAAGTCTTCTGCACCAAGTTTATGTTTGTTTAACACGCGGACAGACACAT GATTGTTCAACTCGCTTAACTTATTCTTACAAATTTCAGCACGTGGATGACCTATGTCACTAAGGTTTGCAAAGTAGTGA GATGTGAGGTCAGCCATACATAAGGGAGTGTCATCACACAACGTAACAGATTTAACTCCAGCCAGAATAATATTTTTAGC GACCTCGAGCCCAAGTCCTTCCAGGCCAATAACTAAAATATCTGTTGTTGCCATTCGGCGCATGCCTTCGGGCCCGTAAA CATAAAGCTGCCGACTATAAAGACTTTCGTCCAAATCAGGAACTTCTCCGTTAGCTTCCATCCCGTTTGATAAATTGCTG TTGGTATTTGTATGAAAATTGTTATTGTTGTTTTCTGTAGAGGTCAGTATTTTTTGTCGTTTGGATGGAGGAGTTGGAGA CATCTAAACACCAGAAATGTCATTCAGGCCTTACAAGACTTAGGCTCGTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CShisMan2_107: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18150923385452AI067485EST209167Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153623385722AI067755EST209438Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157953386155AI068188EST209879Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 9:7:38 on Sat 18 Nov 117.