CShisMan2_1072


Sequence

>CShisMan2_1072 (2 EST) Length=332 ATTACAGGAAATTTCTATTGGCAGCAAATGCGCATATGGCAGAAATACATCTACACGTACAGAAATTAAAGAGAAAATAT ATCCGTCAAATCAAGAACAGATATATAACAGTAAAAAGTAACCATAAAACTGGGAACAATTGTGACAATTCAAAGTTAAG AACACTAATTATAATTAATTATGAAGTTAANGGGATATTATAACCGAACGTATTAATGAGCATCCGTAAGTGCAACAACT CCGGGTAATTGTTTACCTTCGAGAAGTTCAAGACTAGCACCACCACCAGTACTGACATGACTAACTTTGTCCTCNGTGTC CCATTTGGCGCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1072: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39392514786T14619SMEST0280Schistosoma mansoni, adult worm, Gloria Franco
17369283189848AA999293MCCE3105.M1FSchistosoma mansoni, cercariae


Date: 9:50:20 on Fri 24 Nov 117.