CShisMan2_1075


Sequence

>CShisMan2_1075 (2 EST) Length=352 GTTCAGGTACTTCTTCACCAATCTCCTTAGTGCTGTCTGAACTGAGTGACGAACCTTTAGATCTGTTTTTTGGTTTGGAA TCAGTACTTGAAGGTCTGGCAGGACTAGTAAGTGATGGTCTTTCACGAGCTCGTCTCTCCTCGAATTCCTTGATTAAGTC AGGACAATCCAAGTTTTCTTCTGGCTCCCATGTATTGTCTTCCTCTGAGTAACCCTTCCACTTGAGGAAATACTCCTTTC TCCCATTTCTTATACGAACCTTCAGGATTTTTTCCACTTGAAACTCATCTTCACCCGCACTTTCTTCAGACTGCGGACTG TTCTTCGATGGCATNANAACTACAGAGCCTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1075: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39356514750T14583SMEST0244Schistosoma mansoni, adult worm, Gloria Franco
18150373385397AI067430EST209112Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 15:20:28 on Thu 23 Nov 117.