CShisMan2_1078


Sequence

>CShisMan2_1078 (7 EST) Length=462 AGAGTATGAGAATGTGTAAACACTGCAAAGAAAACAGTATGATGTTTATCAATCCCGTTCTGTTTTCCCCCTGGGCTTTT ATGAAAAGGTGCCTTTTTTATTGCCCTAGAAAATTGTGGCCTTGGCTAAAAAATCGTGTAACTCGACTTCGTTTACGATA TAATTATTATACTTAAAATATGATACTGTCATTCTCATTGTTTCACTTATCATTCTTATACCAAATGAGCTGCATTGATT CCCTGGTATTTACCTACAAACTGATGACAAATCATCTTCATTTTTATGGTGTGTCTTATAACATTTCTCGTTTATATAAT TTTAAGTCTTTGGTATACCTTTTGTTTTACAGACCGCTTATTTTGCCGCCACAGCATTAGACATTTCTTGTATAAATTAA TTCCGTTAACTTATTTCAGTCTTCAACTGCAATTGCGGGGTTCTAATAATATTCATAGCAGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1078: (7 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39154514548T14381SMEST0042Schistosoma mansoni, adult worm, Gloria Franco
344398972799L46931SCMRAP018C2/C2 adult worm mini-library
4071391119145H98260SMNHADA015004T3SmAW
17369863189906AA999351MCCE3186.M1FSchistosoma mansoni, cercariae
17370163189936AA999381MCCE3225.M1FSchistosoma mansoni, cercariae
17371783190098AA999543MCCE3460.M1FSchistosoma mansoni, cercariae
17371993190119AA999564MCCE3490.M1FSchistosoma mansoni, cercariae


Date: 17:6:29 on Thu 23 Nov 117.