CShisMan2_1082


Sequence

>CShisMan2_1082 (2 EST) Length=336 AAAAATNNTTCCTTAGGGCCTGNTTGGAATANTTGGAGGAGAAGACCAACCCCAATTGACCAATGGAAAACANATACCAA CTTCGAGAGGAAAGAAATACTTGGTATAGGTTTATACAGAATTGCGTCGTTTTCCAAGATGGATTTCATGAACTTACATT ATCTCCAACANAGTTGGTTTTGCATGGCTTGCATGAACATGGTGTTACATCAGGAGAGTATAGACATATTTTCGGAATTC CTGGTCGATTNCCTCAAAATGAACCACAATAGAAATGGATCAGGGATTTGATGAATAAATCATTCGGACTTCAATCAATA GGTTGTAGGTTCGGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CShisMan2_1082: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4156521122595H98374SMNHADA015040T3SmAW
4350251154049N33650SMNHADA008068SKSmAW


Date: 12:35:3 on Tue 21 Nov 117.