CShisMan2_1085


Sequence

>CShisMan2_1085 (2 EST) Length=331 TGTTGTTAACAGTTTCTATGNATTAGCAACAATTTCATTAATGATTATCAGTTGTCAATTCATTACAGGTTTCGTTGTAC ATGAAAGCAGTACTGAAGGACAAAAATCATGAAGAATCACAATTTTTCCTTGNCTCCATTGGCGGCGGCTGCTGGAGCTC ACTTCTTACAATTTTTAAATGGATGCTTCTTGGAATATGGACAATCTGAAGAAGTTGGTTTTTCCTGGATAAAATACAGA AATACAAACAAAAGAAACTTCTTATGATTAAGTCATTATAAATTTAAATTGAAACATCTTTTCTTATGAATAATAAATGT GGGAAATTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1085: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4180141125903N20731SMNHADA007045SKSmAW
4191281127979N21846SMNHADA018069SKSmAW


Date: 5:59:50 on Sun 19 Nov 117.