CShisMan2_109


Sequence

>CShisMan2_109 (2 EST) Length=604 ATGGATACGACCCTCGGTTCTATCCGGGTTAGTTCACACGCTGGAAGCTGGTATTCTGCAGACAGAACAGAGTTGTCATC ACAGTTAGACACTTGGTTAGAAAGTTGTGAAAACAATGTTTCGAATGGATCTTTAGTCCGGGCAATTATAGTACCTCATG CAGGTTACCGACATTCTGGTTTATGTGCAGCCCACGCGTACCGTCTAATAAATCCTGACAAAATAGAATGTATTTTTAAC ATAGGTCCCTCACATCGTCTAGATATTNGGGGATACATGCGCTCTGACTTGTGTATCTGAGTATGAAACTCCATTTTATA ACTTAAAGATCAATACTAATGTATACAACAGCCTTAAAAGTCTTAACTGCTTTAGCGTTCTGGAAAAGAGTCAGGACGAA GCTGAACACTCTGTGGAAATGCAGTTACCGTATATTGCTCACATCATGAAACGTAGGAAAAGTCAGTACTCCATAGTTCC CATAGTTGTCGGTTCCTTATCATTTGAAAACAGAATTCTTCGGGAACTCCTATCAAGCTATCTGCTGGATGAGAAGAATC TCNTTGTGATATCTCTGATTCTGTCATTGGGGAACGATTCGATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_109: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8578281832588AA218495MAAD0162.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
8578341832594AA218501MAAD0169.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)


Date: 2:45:18 on Mon 20 Nov 117.