CShisMan2_1091


Sequence

>CShisMan2_1091 (3 EST) Length=332 GTTGACATTGCCTGGTTAAGAACTGCAGACTCTAAAACCTGAATTATATTTGGGCAATTAAAAGGAGCTTAGCTGAGTGA TGTGAGTAAAAGATTGTCTTCTTGGGCCAAGATTTGCTGTCATCAATCATAAACAGACATAAACCCAGAAAGGAGATCTT GTAGAAAATATTTATGTCGGTTACTATGCACTTGGGTTTTGTGGGATGTGTGTATTTTTCCAACAGTTAATAGCATAGAG ATCAGTGTGCACAAGTTAGCTCTGGACTATTTTTCTTTCTTGCCCCCTCTCTTTTTTCCTTACAATTAATGACCTGTGCT CATATATTTGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1091: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17609493237170AI021758ME0104.R1RSchistosoma mansoni, egg stage
17609503237171AI021759ME0105.R1RSchistosoma mansoni, egg stage
17609513237172AI021760ME0119.R1RSchistosoma mansoni, egg stage


Date: 9:49:1 on Fri 24 Nov 117.