CShisMan2_1099


Sequence

>CShisMan2_1099 (5 EST) Length=391 GCGTATTATCTACTTATAATCAACTAAGAATTAGTTTCGGCTACTTTATTGAATTAAAATTCTTAGACTCATTGAATGTT GATATTCTTTTTTAGCTATTAAAGATGTTTATTCTGCTCTGGCTGTCTGATAAACGCCATATCTAAATCGCTTGTTTAAA CGCTTAACTAGATGCTTACAACAGCGGCTAATTTTTCACCTAAATTATCTTCTTCAAGATATTTTCGAATTTTAACTCGA CAGTTATGTTCAAATCTCTTCCAAAGTTCTGTGATTGACTTCCATAACTTCACACTTTCAGTAAATAGTTCCTTTTGACT AGCTTGGGATTCAGCAGTTACATTTAACAGCAACGAAATAATTAGTGCAAATCTTAAGATGAGCTCGTGNC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1099: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344844975900R95498EST000055S. mansoni cDNA
4179721125861N20689SMNHADA001026SKSmAW
4236041139705N25357EST000457S. mansoni cDNA
4236051139706N25358EST000459S. mansoni cDNA
15130162854296AA791341SMTBADA000823SKSchistosoma Lambda Zap II


Date: 23:32:20 on Fri 17 Nov 117.