CShisMan2_1102


Sequence

>CShisMan2_1102 (8 EST) Length=516 ATTTTTTTTTTTCTGAATATAAAACTTTTATTTGAAGTATTCAGTATACACTTGCAATGGCTTGATTAACTCTAATTAAC ATTTTGAGATGATGTTCAAAGATTGTGATATTAGTTTATTTGACCGGCTATTACTTCAGATTCAATGAAACACTCATCAC GACCACGCACTATTCTGAAATATCCATTTTCACCCCAATCTTCATTCCACGAATTCGCAATCAACCAATAAGGAGTCTTG TTTTCCACACCCCATCCGATAATACGTATAGCGTGCCCACCAAGTGCTTCTCCAGTAATATGTTTATAGATTCCAGATTT GTAATTTAGAAAATCTTCATAAACGGTGAAGAATGCTTCTACTGGTCCGTATTTCATGATTTCTTTTTGAATAGCCTTTT CATCATTTTTAACATTGTAGGATGATTTACCTCGATGCTTGTCTTGGGNGTACGGNNTTTTATATTTTTTCTGACAAGTT TGTTTACAACGAGGAGCCTTGTAGATTTTACTACCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_1102: (8 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39134514528T14361SMEST0022Schistosoma mansoni, adult worm, Gloria Franco
39420514814T14647SMEST0308Schistosoma mansoni, adult worm, Gloria Franco
344887975943R95573SMNHADA008036SKSmAW
344963976019R95534SMNHADA018095SKSmAW
6000891377934U58056SMU58056Schistosoma mansoni adult worm Lambda ZAP II library
7823901713228AA143823MCCE0122.M1FSchistosoma mansoni, cercariae
11587362252913AA514057MA2MA121.AA3S. mansoni adult Lambda Zap
17372103190130AA999575MCCE3520.M1FSchistosoma mansoni, cercariae


Date: 12:40:28 on Sun 19 Nov 117.