CShisMan2_1107


Sequence

>CShisMan2_1107 (2 EST) Length=342 TCTTGTGCTACGGGGTCAATTTCAAGGGCCATAGAATCAAATATTGAAACCTCCGGCTGGTAGTTGTCTCCTCGTTCTCT TTCTTCTTCCTGAAGCTTAATACTAATACCACGCACAGGGCCAGCTTCGAAACGCTTCATCAAATGAGTCACATAACCTG CGATCATGTTTGCGCAATCTTTTTGACCCTATGCATGCGATGTCTTGNACAAAGCGATATTTGTTGGTATTGGAAGCTCT CGGGTCAAGTTTGAAGTAAANCCTTTCCGATTATATACCTCGAAGCTGTCTTCACTGTCTTTGTTCGGACTCGACCCATG ACCACTCAGTTTTTCAAGTTAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1107: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5858841377945U58066SMU58066Schistosoma mansoni adult worm Lambda ZAP II library
7641631685479AA125727MLLG0170.M1FSchistosoma mansoni, lung stage


Date: 16:21:54 on Sun 19 Nov 117.