CShisMan2_1113


Sequence

>CShisMan2_1113 (9 EST) Length=371 CGGCACGAATATTTTTTTCTCAAAGCCAATGTCAATTGCTGACATTACTGAGTTATTCGGAAAACTTGACAAAAATCATA ATGGCCTTGTATCACAAAAAGAAATTAAAGCTTATCTGAGGTCAAATTCTACTAAATATAACTGTAAAGAGGTTAAGGAA TTCGTTGGAAAAATTGATGACAACTCGGATGGTCAAATTAGTTTGGAAGAACTGACCAAAGCTTTGTCAGGAAATTTAGA CATTGCCAAAGCGTGTCATCTAAAGCCACGATAAATAATACGAAGTCTTATATACATAAAATTCAGATTTTTAATTACGT TCTTCTTTAAAAACTGTTATTTACTTAATATAGCATATATAGACATGTTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1113: (9 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12098262330115AA559419MC250432.NA3TBRI-Saber-cercaria-A
12098482330137AA559441MC260425.NA3TBRI-Saber-cercaria-A
12098612330150AA559454MC260445.NA3TBRI-Saber-cercaria-A
12099792330268AA559572MC070578.NA3TBRI-Saber-cercaria-A
12101562330445AA559749MC140326.NA3TBRI-Saber-cercaria-A
16099872992136AA883025SMTBCEA000054SKSchistosoma Lambda Zap II cercariae
16452383056736AA917193SMTBCEA000339SKSchistosoma Lambda Zap II cercariae
16891503116519AA952813SMTBCEA000192SKSchistosoma Lambda Zap II cercariae
17371203190040AA999485MCCE3360.M1FSchistosoma mansoni, cercariae


Date: 2:45:22 on Thu 23 Nov 117.