CShisMan2_1119


Sequence

>CShisMan2_1119 (4 EST) Length=578 GTAGCAATAACAATCTATATTTCACAAAANACAAAGCTAAGTTACATGAAATAAATCACATGCCAACAAAACATGTCACG TTCATTTTATTCCGTACGTTTATCCATTTATATGTCTCGATGAGAGTGAAATACCTTACTTTGTAGAAAAATTAGAAAGA AGAGCACGTGATTTTATCCACCAAAATTAATAAACACTCAAAAGAAAAGATGTAGTTCTGTCGAAAGATAAACGTTTTCT AATAATAATATCGGCTATAACGAGTATCGTCATATATATCTACTCGTTGAAGTTGAGAAGCTGGACGTGAATATGAATAG CCATAAAGCGAATTCATCCAATAATCTGAGAGACTACAAAATGATCGAAAACGACGTAGAGGAGACACATAGTTATAACT TGGTGAATATGTACTTTGATAATAACTAGGGGTACTTGTGTAGTCTCTGTAAATATAAATCCGTTTACCGTAGCGCAAAT CATCACTTATTTGTCGTGAATCCCTATATGAATAGCGGTAGTCTGAATTCATCCAGGGTTTAAAAACACCACTGTCGTCG TAATAACCGACCAAGTCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1119: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7824191713257AA143852MCCE0227.M1FSchistosoma mansoni, cercariae
16891943116563AA952857SMTBCEA000532SKSchistosoma Lambda Zap II cercariae
17369823189902AA999347MCCE3174.M1FSchistosoma mansoni, cercariae
17371883190108AA999553MCCE3478.M1FSchistosoma mansoni, cercariae


Date: 18:56:2 on Thu 23 Nov 117.