CShisMan2_112


Sequence

>CShisMan2_112 (2 EST) Length=605 GATTATTAATAACAATATAATTTCAGAAATTGCTAACATCAAAAATACTCATTTAAATTAAATAAATGAGACCCGTATAT TTCACAAAAATGAAAACGTCGACTACATTTGTAAAATAAAGATATCGGAGTTGGCACCACAGAAACAGTTCGCTGCTTTC AAACCCTCCAAGTAAACGCGGTTACAAGTGTTAAAACGAATCGGCAAGTCATGTATAAAAAAGGATTTGCATAAAGAAAT ATCCAGGTTCGATAAAGATTAGCTGCGTCTTAAACGTTTAGCTCGTCCTCTACTTCTGCCTCTGCTGACGGATTGTGGGG GGGGAACTTAGTTGTGGATTCGTTCAGGTGATTGTGTGATAGGGTCTCAGGGGCAACAAATTTAGATGATGCTGTACGCC GTCGAGATGACAGCCGTACGCTGTTATTTATTTTTTCCCCATGTTTACCAAGTGCTTGGGATGTTGAGCGGTCTAGTTCA TCAGACTCAGTTTTCATATTGAGGTGTGTAATGTCTCGTACTTCAGGTATTTGTACAGAATCTTGTTCATTTTTCCCATC GACAGAAATAGCTGGTGTTTCANCCGTAAGTTTTGGGCAAANCTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_112: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7823761713214AA143809MCCE0102.M1FSchistosoma mansoni, cercariae
7824021713240AA143835MCCE0204.M1FSchistosoma mansoni, cercariae


Date: 16:6:3 on Tue 21 Nov 117.