CShisMan2_1123


Sequence

>CShisMan2_1123 (2 EST) Length=464 CGGCACGAGGTTTAATAGTACGCCCTGTAACGTAACTAACTGAAAGGGACGTTCTGATACCCTGTGTAGAATGTGGTAAA AATGACTATTGGTGTTCATTTAACAAGACTGGTGTATAGATACTAAAACAGCGTTCTTTATTGNAAAATGACTGTCCCAT CACCTTGCGACAGTATCCCACAACCACAGTTTGATTTTGAAGAAGAGTATGATCAATTGAATGCTCAATTGGATGCATTG TCAAAGTGTTTAGATATATTAGAAGCAAAAGGGTAAAAAAGTATGTGACGAAAGCTCAACGTCTTATTATTGAATATAGA AATTCAAAACTATGAAAAATCATCTTGAAATGAGTTATATTCAACATACNCNCATCACATAAATTATCAATGTATTTCTT TTTCATTTATTCCAACCGTTGCTGCTACCTTGACGTGGTGGTCGGGCTTGCCATTTATAAACAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1123: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12098052330094AA559398MC250405.NA3TBRI-Saber-cercaria-A
12098832330172AA559476MC260475.NA3TBRI-Saber-cercaria-A


Date: 18:46:31 on Thu 23 Nov 117.