CShisMan2_1126


Sequence

>CShisMan2_1126 (7 EST) Length=633 AGATAAGTATGATTATATTCTGAGAACAGGAGGAAAACAAGATATCGGATAATTAGATAAGATAGATTTTGTATCAAAAT GATTTAACAGTAACTTACACAAAGTAATAATTTCTAACTCCTAAATGAATGGATATTACAACTGAAGAAAAAGTTACTGC TTCTCTTGAGGTGGGACGATGACTACAGGGATATGAGAGTGATGAAGAACATAATCGCTAACACTCCCCAAGAATGTACG ACGAATAGCTCCAAGACCACGATTGCCCATCAGAATAACGTTTGCTTTATGGTCTGAGATTGCTTTCACTAGAGAGCTAC CAGGTTTGGTGTCAACATGTAGAAACGCCTTAGCATTGAGCTTGTAACTTTTAGCTTCGTGCATATACTTCTGACCAAGC TTTTTACCTTGTTCAATGCTTTCTTCCATAACTCGTGTCATATCAGGTATTGGAGGAGATTCCATTGTCATTCCAATGGC TGGAGTGTTATAAACTGGCTCTATTACGTGTACAAATGTTATGCAGTCAGTGTCCCGTTTCATATTTTCCAAGTACCAAC GAAATGCTCGATCACAATGATCACTGCCATCAATTGGGATCAATATCACACGAGATGGATCACTAGACTCAGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1126: (7 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4179781125867N20695SMNHADA001045SKSmAW
11587022252879AA514114MA2AS020.AASS. mansoni adult Lambda Zap
12101842330473AA559777MC210228.NA3TBRI-Saber-cercaria-A
12101942330483AA559787MC210284.NA3TBRI-Saber-cercaria-A
13277492552086AA629475MU000021.Y2RSmL
14785782804074AA756904MF4MA146.AF3S. mansoni female adult Lambda Zap
17369523189872AA999317MCCE3131.M1FSchistosoma mansoni, cercariae


Date: 10:29:13 on Mon 20 Nov 117.