CShisMan2_1131


Sequence

>CShisMan2_1131 (2 EST) Length=550 AATTTTTGACACGATTTTATTGGCATTTTATTTCCAGATCATTCAAAACGACTAGCTTTTGGATGGGATTTATTCAATTA AAAGGAATAACAAATTTAATATGGTAGAGTAAGANACTNCACTATTATGATTAACATCTAATATTATNCCAAATTTNCGA GGAAATCAAAGTGGATTGGAAACATGANTATTTTANGGGCATATCAGCTTTTTNCTTATTTGGCCTTTGATCAAAATGTG GCCGCATCATTCACTCCCAGTTGACATATATNANGAGATTGACATAATANTGAGTTAACATAGCATATTCAATCACGCTA TCACAATGTTATGCTTGCAACATAAGCGGTCAGTTTGGCAAACGACGGAAAGAGACCAAACTAATAACGGCTAGCTAACG TCAACAATATTTAATTACAGGGGAAATATCACGAATAATTCGCTTCATAGAATAAAGAAAATCAACTTCGTTTAATCGAA AGATATCAACTGAGCCTCCACAGCACCCGGCTCAGATAGTTGTTAGGTGCATCACTTGGATGGGTCACAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1131: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39185514579T14412SMEST0073Schistosoma mansoni, adult worm, Gloria Franco
12165912338840AA566208MC3NE028.ACSS. mansoni cercarial Lambda Zap


Date: 0:53:47 on Wed 22 Nov 117.