CShisMan2_1134


Sequence

>CShisMan2_1134 (2 EST) Length=364 AATCAATTAATTTTTATTAAAAAAAACCGACAAAAACTAATTTGCACAGTAGTTATAATTTTTTTCCAATTTAGTAACAT TGCAGGAAATTGAGGANATTTTCTAAAAGCAGCATCAAGANTTTGAAAGGGGTTTCATTGAGGTCGNAACCCGAATCAGT ATGAAGAACTTGTGTTTTTGGGTTAATTTGATCGAAAAAAGCAAAAACGTCAAATTTTCTAGCTTAAAGTGAATGAAATC CACCTGTTTCATGAGTGAAGGACCCACAAAAATTCTTGCCAGACTACACATTGCCAAGTAGTTTTAAAAAATCTATCAAA ATTTCTCTTGATNAAATGAACNANACTACTCCAATCAGAATCCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1134: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4156411122584H98363SMNHADA015012T3SmAW
7824401713278AA143873MCCE0256.M1RSchistosoma mansoni, cercariae


Date: 1:47:48 on Sat 18 Nov 117.