CShisMan2_1139


Sequence

>CShisMan2_1139 (2 EST) Length=325 CGCCTCGTTTGTTTCTCATCATGATCGTGTATAAGGATATGATCACTGAGGATGAAATGTTCACAGACTCGCACTGTCCT CGTGTTGTCGCGGATTTCTTTTATGAAGTCGACTCGAGGTTTACGACAGTTTCAAGTAATGTAGATGGAAGACTTATTGG CGCCAACCCATCTGGTGAGGGTGGAGAAGATGAAAATGTGGATGATACGAGCAAACAGGGTCATTGATTTAGTTCACGCT AATGGTTTCATTAGTGTTCCTTTCGACCAAAAGATCATACAAAGCGCATCTTAAGCTGTATTTAAAAACTATAATAGAGC GTTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1139: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4179641125853N20681SMNHADA001003SKSmAW
12101382330427AA559731MC041007.NA3TBRI-Saber-cercaria-A


Date: 7:11:35 on Mon 20 Nov 117.