CShisMan2_1141


Sequence

>CShisMan2_1141 (47 EST) Length=1383 TTTCTTGNACTCCACACCATATTGTAATAAAATGTCACGCTTCCAACCTTACCTAACTGAAGCTCAAGAGAATGACCTAC GCCGAATTGCTCAAGCTATTTGTGCTCCTGGCAAAGGAATTCTAGCAGCTGACGAAAGCACAGCCACAATGGGCAAAAGA CTTCAACAGATCGGCGTTGAAAATAACGAAGAAAATCGTCGTCTGTACCGCCAGCTACTTTTTAGTGCTGATCACAAGCT GGCCGAAAATATCTCTGGAGTAATATTATTCGAAAGAGACACTTCATCAAAAGTCAGACGATGGAAAGACTCTTCCAACT CTACTAGCTGAACGAAATATCATACCAGGAATAAAGGTTGATAAAGGTGTTGTTCCACTTGCAGGCACAGACAATGAGAC AACAACTCAGGGTCTTGATGATCTTGCTTCACGCTGTGCTGAATATTGGAGACTTGGATGCCGCTTCGCTAAGTGGCGTT GTGTTTTGAAAATCTCTTCACACACACCCTCTTATCTAGCTATGCTCGAAAATGCTAATGTACTTGCACGTTACGCTTCC ATCTGTCAGCAGAATGGTTTGGTACCGATTGTTGAACCTGAGGTGCTTCCTGATGGTGATCATGATTTACTAACTGCTCA GAGAGTAACAGAACAAGTTTTGGCATTCGTGTACAAGGCTTTGGCCGACCATCATGTTTACTTAGAAGGAACGCTTTTAA AACCCAATATGGTTACTGCTGGACAGGCCTGCAAAAAAGCTTACACACCACAAGAAAATGCTTTGGCTACTGTGCGAGCT CTTCAGCGCACAGTCCCTCCAGCTGTTCCAGGTATCACATTCTTGTCCGGAGGTCAATCAGAATTGGACGCTACTAAAAA TCTGAACGAAATCAACAAGATTCCGGGACCAAAGCCATGGGCACTCACTTTTAGTTTTGGTCGTGCTCTGCAGGCTTCAG TCTTAGCCACATGGAAGGGAAAGAAAGAAAATGTTCATGCGGCTCAGGAAGAGCTATTGAAATTGGCCAAAGCAAATGGC GCTGCTGCTGTTGGCAAATTTGAAGGAAATATGGGAACTACTTTGGGAGACAAATCATTGTTCGTTGCTAATCACGCTTA TTAAACCACTACATCATCCAAATGTCATCTAATTTGAAGCCCCTCGATATTTAGCGCAACTAGTCGACATCATAACTAAC TGACTAACATTTTTCATATGATTTAAGATTAAACCAACTTTCAGATCAATTCTGTTTTATTTTTATTTTTGTTCTTAAAT ACCGCCATACATTTCTTAAGAACAACAATATTTACCGTTGTACTTCATAGTATTAGTTGGTTAATGAGGTCATAATAACC AAGTAAATATACATTCTCCCTAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1141: (47 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39236514630T14463SMEST0124Schistosoma mansoni, adult worm, Gloria Franco
39237514631T14464SMEST0125Schistosoma mansoni, adult worm, Gloria Franco
39303514697T14530SMEST0191Schistosoma mansoni, adult worm, Gloria Franco
39309514703T14536SMEST0197Schistosoma mansoni, adult worm, Gloria Franco
39379514773T14606SMEST0267Schistosoma mansoni, adult worm, Gloria Franco
39384514778T14611SMEST0272Schistosoma mansoni, adult worm, Gloria Franco
39386514780T14613SMEST0274Schistosoma mansoni, adult worm, Gloria Franco
60699529729T24126SMEST0324Schistosoma mansoni, adult worm, Gloria Franco
5137031444956W06736SMEST0372Schistosoma mansoni, adult worm, Gloria Franco
7641731685489AA125670MLLG0208.M1FSchistosoma mansoni, lung stage
7791301702789AA140565MEEG0225.M1FSchistosoma mansoni, egg stage
7823961713234AA143829MCCE0130.M1FSchistosoma mansoni, cercariae
12098982330187AA559491MC270417.NA3TBRI-Saber-cercaria-A
12099562330245AA559549MC070547.NA3TBRI-Saber-cercaria-A
12100462330335AA559639MC090743.NA3TBRI-Saber-cercaria-A
12100472330336AA559640MC090745.NA3TBRI-Saber-cercaria-A
12100782330367AA559671MC180917.NA3TBRI-Saber-cercaria-A
12100842330373AA559677MC180926.NA3TBRI-Saber-cercaria-A
12100862330375AA559679MC180928.NA3TBRI-Saber-cercaria-A
12101452330434AA559738MC140307.NA3TBRI-Saber-cercaria-A
12101472330436AA559740MC140309.NA3TBRI-Saber-cercaria-A
15469442897565AA825087SMTBCEA000003SKSchistosoma Lambda Zap II cercariae
17369023189822AA999267MCCE3068.M1FSchistosoma mansoni, cercariae
17369353189855AA999300MCCE3112.M1FSchistosoma mansoni, cercariae
17369533189873AA999318MCCE3132.M1FSchistosoma mansoni, cercariae
17369813189901AA999346MCCE3172.M1FSchistosoma mansoni, cercariae
17370353189955AA999400MCCE3249.M1FSchistosoma mansoni, cercariae
17370373189957AA999402MCCE3252.M1FSchistosoma mansoni, cercariae
17370553189975AA999420MCCE3275.M1FSchistosoma mansoni, cercariae
17370563189976AA999421MCCE3276.M1FSchistosoma mansoni, cercariae
17370593189979AA999424MCCE3280.M1FSchistosoma mansoni, cercariae
17370633189983AA999428MCCE3284.M1FSchistosoma mansoni, cercariae
17370913190011AA999456MCCE3319.M1FSchistosoma mansoni, cercariae
17371403190060AA999505MCCE3408.M1FSchistosoma mansoni, cercariae
17371503190070AA999515MCCE3424.M1FSchistosoma mansoni, cercariae
17371623190082AA999527MCCE3440.M1FSchistosoma mansoni, cercariae
17372523190172AA999617MCCE3593.M1FSchistosoma mansoni, cercariae
17580713233250AI018914SMEST0554Schistosoma mansoni, adult worm, Gloria Franco
17581003233279AI018943SMEST0583Schistosoma mansoni, adult worm, Gloria Franco
17581123233291AI018955SMEST0595Schistosoma mansoni, adult worm, Gloria Franco
17581263233305AI018969SMEST0609Schistosoma mansoni, adult worm, Gloria Franco
17581353233314AI018978SMEST0618Schistosoma mansoni, adult worm, Gloria Franco
17581503233329AI018993SMEST0633Schistosoma mansoni, adult worm, Gloria Franco
17581643233343AI019007SMEST0647Schistosoma mansoni, adult worm, Gloria Franco
17581853233364AI019028SMEST0668Schistosoma mansoni, adult worm, Gloria Franco
18694143509815AI111127MF003H07.NK3S. mansoni, female enriched, subtractive, HHU(A)
18694263509827AI111139MF003G06.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 21:54:0 on Fri 17 Nov 117.