CShisMan2_1142


Sequence

>CShisMan2_1142 (89 EST) Length=1371 AATCTAACCATCATCACACTAAGTCTAACGGAATAGATTAACTTCAGAACTCCGACGTAAGTGAATCTATTCTCTATTAA CCCTTCATCCGTACACTCGTATCTCTCCACACCCCAAATAACGAAAAATAATAAAACTACGAAACCTACTCAACCTCGTA GTTTAAATCTAAATAACCTAAAATTAGGCTCGAGTTTTTTTTTTTTCCTTTTTTTAAGTAGAGGCAGATTAACGCTTTAT TCGTTATCTATCGATTGACAAAAAGTTAGTCGGCTACAGTTGAAACTACTTCATTATGCATGGTCGACTTTATGCATGTG CGTAATGAGATCAACTACGCGGCAACTGTATCCAAACTCATTATCATACCATGAAACTAATTTCACGAAGTTGTTGTTAA GAGATATCCCAGCCTTCGCATCAAAGATAGATGAACTGGTACTTCCAACAAAGTCTGAACTGACAACCTCATCTTCAGTG TATTCCAAAATCCCCTTCAATGGTCCAGATGCAGCTGCTTTAACTGCAGCCTTGATTTCCTCATAGGAAGCTCCCTTCCC TAACCTACATGTCAGATCAACGACTGAAACGTCTGGTGTTGGGACGCGGAAAGCCATTCCCGTTAATTTTCCGTTTAGTG CTGGAATGACTTTTCCCACAGCTTTGGCAGCACCAGTGGAAGCTGGAATAATATTTTGCATCGCTCCACGGCCATCTCGC CATAATTTTGAGGATGGTCCATCTACAACCTTTTGTGTAGCCGTAAATGAGTGCACAGTGGTCATTAAGCCCTCAACTAT TTCAAACTTATCATGAATGACCTTAGCCAGAGGTGCTAAACAATTAGTTGTACATGATGCGTTAGAAACCACGGACATAG ACTTTTCATACGAATTTTCATTCACACCAACAACGAACATGGGTGCATCTGCAGAAGGTGCAGATATTATGACCTTTTTA GCTCGATTATTTTTAATATGAGCCTGAGCTTTATCAATGGTCGTAAAGACTCCAGTAGACTCAACGACATATTCAGCCCC GTCCTTATCCCACGGGATGTTTGCTGGATCTCTTTCACAATGAACTGATATTAACTTCCCATTGACTTTTAACTTTCCGT TTTCAGTCGAAACCTCGCCTGGAAATGTCCCATGAGTGGAATCACGTTTTATCATGTACACCATATACTCTAAATCTATG AAGGGGTCATTCACCGAAACTACATCCACGGTGTTCTTGAGGAAAGCTGCACGAAGTACAAGTCTCCCGATACGACCAAA ACCGTTAATACCAACCTTTGCTCTCGACATCTTGAAGTATATCGTACGTGACTTCGCTGATGGCACCACGCAGCAGTATA TACAACTTAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_1142: (89 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39198514592T14425SMEST0086Schistosoma mansoni, adult worm, Gloria Franco
39199514593T14426SMEST0087Schistosoma mansoni, adult worm, Gloria Franco
39206514600T14433SMEST0094Schistosoma mansoni, adult worm, Gloria Franco
39207514601T14434SMEST0095Schistosoma mansoni, adult worm, Gloria Franco
39338514732T14565SMEST0226Schistosoma mansoni, adult worm, Gloria Franco
39343514737T14570SMEST0231Schistosoma mansoni, adult worm, Gloria Franco
344888975944R95574SMNHADA008062SKSmAW
344900975956R95586SMNHADA00E034SKSmAW
349687988318R95583SMNHADA00E001SKSmAW
4291611145887N28031EST000099S. mansoni cDNA
5137511445004W06784SMEST0420Schistosoma mansoni, adult worm, Gloria Franco
7641371685453AA125701MLLG0115.M1FSchistosoma mansoni, lung stage
7641451685461AA125709MLLG0131.M1FSchistosoma mansoni, lung stage
7641961685512AA125693MLLG0267.M1FSchistosoma mansoni, lung stage
7808241705419H98306SMNHADA016070T3SmAW
7823971713235AA143830MCCE0131.M1FSchistosoma mansoni, cercariae
7824001713238AA143833MCCE0201.M1FSchistosoma mansoni, cercariae
8578091832569AA218476MAAD0140.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
11587562252933AA514077MC2AS032.ACSS. mansoni cercarial Lambda Zap
12097802330069AA559373MU002060.NH3York-Harrop-lung-A
12098402330129AA559433MC260411.NA3TBRI-Saber-cercaria-A
12099392330228AA559532MC070523.NA3TBRI-Saber-cercaria-A
12100532330342AA559646MC240703.NA3TBRI-Saber-cercaria-A
12101502330439AA559743MC140315.NA3TBRI-Saber-cercaria-A
12101712330460AA559764MC140346.NA3TBRI-Saber-cercaria-A
15130382854318AA791363SMTBADA000907SKSchistosoma Lambda Zap II
16099812992130AA883019SMTBCEA000048SKSchistosoma Lambda Zap II cercariae
16452063056539AA917145SMTBCEA000094SKSchistosoma Lambda Zap II
16452483056746AA917173SMTBCEA000358SKSchistosoma Lambda Zap II cercariae
16716013096905AA938794SMTBADA000482SKSchistosoma Lambda Zap II
16891323116501AA952795SMTBCEA000156SKSchistosoma Lambda Zap II cercariae
17369193189839AA999284MCCE3093.M1FSchistosoma mansoni, cercariae
17369453189865AA999310MCCE3124.M1FSchistosoma mansoni, cercariae
17370503189970AA999415MCCE3268.M1FSchistosoma mansoni, cercariae
17370653189985AA999430MCCE3286.M1FSchistosoma mansoni, cercariae
17371363190056AA999501MCCE3404.M1FSchistosoma mansoni, cercariae
17371413190061AA999506MCCE3411.M1FSchistosoma mansoni, cercariae
17371793190099AA999544MCCE3462.M1FSchistosoma mansoni, cercariae
17371803190100AA999545MCCE3467.M1FSchistosoma mansoni, cercariae
17371923190112AA999557MCCE3482.M1FSchistosoma mansoni, cercariae
17372003190120AA999565MCCE3492.M1FSchistosoma mansoni, cercariae
17372023190122AA999567MCCE3497.M1FSchistosoma mansoni, cercariae
17579813233160AI018824SMEST0462Schistosoma mansoni, adult worm, Gloria Franco
17579823233161AI018825SMEST0463Schistosoma mansoni, adult worm, Gloria Franco
17579833233162AI018826SMEST0464Schistosoma mansoni, adult worm, Gloria Franco
17579873233166AI018830SMEST0468Schistosoma mansoni, adult worm, Gloria Franco
17579883233167AI018831SMEST0469Schistosoma mansoni, adult worm, Gloria Franco
17579943233173AI018837SMEST0475Schistosoma mansoni, adult worm, Gloria Franco
17579953233174AI018838SMEST0476Schistosoma mansoni, adult worm, Gloria Franco
17579963233175AI018839SMEST0477Schistosoma mansoni, adult worm, Gloria Franco
17579983233177AI018841SMEST0479Schistosoma mansoni, adult worm, Gloria Franco
17580053233184AI018848SMEST0486Schistosoma mansoni, adult worm, Gloria Franco
17580063233185AI018849SMEST0487Schistosoma mansoni, adult worm, Gloria Franco
17580123233191AI018855SMEST0493Schistosoma mansoni, adult worm, Gloria Franco
17580423233221AI018885SMEST0524Schistosoma mansoni, adult worm, Gloria Franco
17580443233223AI018887SMEST0526Schistosoma mansoni, adult worm, Gloria Franco
17580473233226AI018890SMEST0529Schistosoma mansoni, adult worm, Gloria Franco
17580483233227AI018891SMEST0530Schistosoma mansoni, adult worm, Gloria Franco
17580543233233AI018897SMEST0537Schistosoma mansoni, adult worm, Gloria Franco
17580553233234AI018898SMEST0538Schistosoma mansoni, adult worm, Gloria Franco
17580643233243AI018907SMEST0547Schistosoma mansoni, adult worm, Gloria Franco
17580673233246AI018910SMEST0550Schistosoma mansoni, adult worm, Gloria Franco
17580683233247AI018911SMEST0551Schistosoma mansoni, adult worm, Gloria Franco
17580723233251AI018915SMEST0555Schistosoma mansoni, adult worm, Gloria Franco
17580763233255AI018919SMEST0559Schistosoma mansoni, adult worm, Gloria Franco
17580773233256AI018920SMEST0560Schistosoma mansoni, adult worm, Gloria Franco
17580833233262AI018926SMEST0566Schistosoma mansoni, adult worm, Gloria Franco
17580953233274AI018938SMEST0578Schistosoma mansoni, adult worm, Gloria Franco
17580983233277AI018941SMEST0581Schistosoma mansoni, adult worm, Gloria Franco
17581073233286AI018950SMEST0590Schistosoma mansoni, adult worm, Gloria Franco
17581083233287AI018951SMEST0591Schistosoma mansoni, adult worm, Gloria Franco
17581513233330AI018994SMEST0634Schistosoma mansoni, adult worm, Gloria Franco
17581633233342AI019006SMEST0646Schistosoma mansoni, adult worm, Gloria Franco
17581663233345AI019009SMEST0649Schistosoma mansoni, adult worm, Gloria Franco
17581683233347AI019011SMEST0651Schistosoma mansoni, adult worm, Gloria Franco
17581693233348AI019012SMEST0652Schistosoma mansoni, adult worm, Gloria Franco
17581753233354AI019018SMEST0658Schistosoma mansoni, adult worm, Gloria Franco
17581773233356AI019020SMEST0660Schistosoma mansoni, adult worm, Gloria Franco
17581803233359AI019023SMEST0663Schistosoma mansoni, adult worm, Gloria Franco
17581833233362AI019026SMEST0666Schistosoma mansoni, adult worm, Gloria Franco
17581863233365AI019029SMEST0669Schistosoma mansoni, adult worm, Gloria Franco
18147553385115AI067148EST208819Schistosoma mansoni, Phil LoVerde/Joe Merrick
18148913385251AI067284EST208961Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149893385349AI067382EST209063Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150573385417AI067450EST209132Schistosoma mansoni, Phil LoVerde/Joe Merrick
18151373385497AI067530EST209212Schistosoma mansoni, Phil LoVerde/Joe Merrick
18155423385902AI067935EST209623Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157223386082AI068115EST209805Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157933386153AI068186EST209877Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 21:25:30 on Sun 19 Nov 117.