CShisMan2_1154


Sequence

>CShisMan2_1154 (2 EST) Length=321 GGTGACAGCACTCCCAGTCATTGAAACACAAGCTGGTGATGTCTCTGCCTACATCCCAACTAATGTCATCTCTATCACTG ATGGTCAGATTTTCTTGGAAACAGAATTGTTCTTTAAGGGTATTAGGCCAGCTATTAATGTCGGTTTGTCTGTAAGCCGT GTAGGATCTGCTGCTCAAACTCGTTCCATGAAACAGGTTGCTGGCACCATGAAATTGGAATTGGCACAGTATCGTGAGGT TGCAGCTTTTGCCCAATTTGCCAACATCTGGAACCTGGGATCAGGCGGCGCTGGAATTTCCTAAGAAAGTTAAGGTTCCA A


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_1154: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9103061907424AA269303MS1MM009.AS6S. mansoni sporocyst Lambda gt11
9103161907434AA269313MS1MM021.AS7S. mansoni sporocyst Lambda gt11


Date: 2:19:8 on Wed 22 Nov 117.