CShisMan2_116


Sequence

>CShisMan2_116 (7 EST) Length=715 CGACATGCAATGTTTTTTTGTATATGCTGTTTGAGAATCTGTCCTTTCATCCCGAATTGGCTTGTGAATATTTCTNCTCC AATAATTGATATCCCACTGGTTCATTTCTTCTTTGGGACATTTGTAGGAGTAGTTCCATTATCATTGGTATTCATTAAAG CAGGAACTGTGCTTCAAGAACTTACAGATTTAGGTGTTACTTCTTTAGCTTCATTTTCAACACTGATTATTTTAGCTGGT TTATCACTTCTACCTTTGGTCTTTCGTAATCAATTCCGTGAAGCATTTTTATGATCGACTTAATGTTCTCTCATTCTTGT TATGCTGATTGTTTTGTGTTCATCACACTAACAGGATTAGCTAAAGCATCTAGAAGTGACCATATTGTACATATTATTTG GTGGATGTTTAAAAATATTATTTTCGATCTATTTTAACAGTGTTCAATTCTGTGATGATAAAAGCAATATTGCGAAATCC TGTTGTTTCTCTTCTGCTTTCAATTCTATTTCTGTGATCTACCAACTATTAACACCAAACTTGGTTCTTATTCACGCTAT TTTTCCTATTACCTATTATTTGTCAGTGATTGGCTGTATACAGCTTGTTATCAAATTGTTTCTTTTGTTACTGGGGTTTA AAATGCAGTCATTACATTTATGTGCATGTGCCGNTGATTAATTTGTGNTTGATATATATTCCACCTGTTTACAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_116: (7 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344394972795L46927SCMRAP014G2/KS adult worm mini-library
4179841125873N20701SMNHADA002003SKSmAW
12098002330089AA559393MC100406.NA3TBRI-Saber-cercaria-A
17371643190084AA999529MCCE3442.M1FSchistosoma mansoni, cercariae
18694663509867AI110897MF003D02.NK3S. mansoni, female enriched, subtractive, HHU(A)
18695893509990AI111020MF002A05.NK3S. mansoni, female enriched, subtractive, HHU(A)
18696223510023AI111053MF001F01.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 10:38:8 on Sat 18 Nov 117.