CShisMan2_1165


Sequence

>CShisMan2_1165 (2 EST) Length=328 TAAACAACTGCAANNATGGCAGCGGCCAACTCAGCAATCAGAAGTACGACGAGGAAGAACGCATACATATACAGCATGCA GACGTTTTCCTTTATGGCTCCACAACAACCCAGAAAGCTCACTATCAGGATTATTACTCCGACAACAATAATAGCGATAG GTGCTGCCTGCCAGACTTTGTGTAAATTGTCTCCATATTGACTAAACTTGACTTCCACATAGGCACCAGCCCCAATTAAT ACCAGGGNACATAACAGACAGATGATGTTCAAAACGAATACGCAACTTTTTAGACAACGCATACCAGTACCCAACGTTGC CACCTCGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1165: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39155514549T14382SMEST0043Schistosoma mansoni, adult worm, Gloria Franco
12101352330424AA559728MC041003.NA3TBRI-Saber-cercaria-A


Date: 22:36:10 on Tue 21 Nov 117.