CShisMan2_117


Sequence

>CShisMan2_117 (17 EST) Length=599 GGTAAATATATGCATTTATTGTTAATAGCTAAGATTATCTTTCTTTTAACAAAAACACCTATTCTTGTTTCTTATTTCAG GCTTGAAAAGAAATGAAATAAAGATGTAAATTATCAGAGAGAAATAAAGAAAAAAAGAGGTTGGAGGTAAGATTAGGTTG GGCAAATTTATTAATTCATATTCTTGATAATAATAATAAATAAATGAACTTGGTTTGTTGTTGATGTCATGTATAGGACT AGTAAGATAAATGGGTGACTAGATAATTCAGTACAGAAATATCCTCATAATAATAATAATAATAAGAGTAATAGACATGA CAAGAATATAATTAATTGGATAAGCAATTTCAGTAAATAGTTTTAGAAGCATTTACGGTGAACAATACCCGGACCAGATT CATCATATTCTTGTTTGGAAATCCACATCTGTTGGAATGTAGACAATGACGCCAAAATAGAACCACCAATCCAAACGGAA TATTTACGCTCAGGTGGAGCAACTATCTTGATCTTCATTGTGCTCGGTGCCAATGCAGTGATCTCTTTCTGCATACGATC AGCAATACCTGGGGAACATTGTCGGAACCACCTGGACAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_117: (17 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39113514507T14340SMEST0001Schistosoma mansoni, adult worm, Gloria Franco
39246514640T14473SMEST0134Schistosoma mansoni, adult worm, Gloria Franco
39354514748T14581SMEST0242Schistosoma mansoni, adult worm, Gloria Franco
344894975950R95580SMNHADA008086SKSmAW
345032981299R95639SMNHADA019081SKSmAW
4291821145908N28052EST000293S. mansoni cDNA
11587702252947AA514091MC2NE023.ACSS. mansoni cercarial Lambda Zap
17368873189807AA999252MCCE3047.M1FSchistosoma mansoni, cercariae
17369343189854AA999299MCCE3111.M1FSchistosoma mansoni, cercariae
17371033190023AA999468MCCE3335.M1FSchistosoma mansoni, cercariae
17371573190077AA999522MCCE3432.M1FSchistosoma mansoni, cercariae
17580373233216AI018880SMEST0519Schistosoma mansoni, adult worm, Gloria Franco
17580793233258AI018922SMEST0562Schistosoma mansoni, adult worm, Gloria Franco
17581363233315AI018979SMEST0619Schistosoma mansoni, adult worm, Gloria Franco
17581383233317AI018981SMEST0621Schistosoma mansoni, adult worm, Gloria Franco
17581603233339AI019003SMEST0643Schistosoma mansoni, adult worm, Gloria Franco
18696013510002AI111032MF001H04.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 11:43:38 on Fri 24 Nov 117.