CShisMan2_1171


Sequence

>CShisMan2_1171 (2 EST) Length=359 GAATGTTAGTATCATTTATTACAGAAGACGGATAGAAAAGTGCAATATTTTTACAATTATTCAACATCTGAGCATAAAGT CATCACAAAGTATCCAATCGATCATCATCGCACTCTCTGATATACAAAACATTATTGCACCTGATTCAGAAACCTCTCCC AAACTCCCAGTATGACAATTGTCAATATACTCATCCGTGCTGTGGAGTTGCAAGTTCATATATCTGTCTACAGATACAAG GGTATCCTTTGTACTCCATTCCCCACTTAAGTTTAACAATGACCTGCTTCCCAGTTATTCCACCTGAGAAAAGGCTTCGG ATTATTCATTGCGACCTCCATCAGCGTCAGCTCGTGCCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1171: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7641761685492AA125673MLLG0215.M1FSchistosoma mansoni, lung stage
15900292956653AA864174SMTBCEA000037SKSchistosoma Lambda Zap II cercariae


Date: 10:6:44 on Fri 24 Nov 117.