CShisMan2_1172


Sequence

>CShisMan2_1172 (4 EST) Length=326 TGAAGCTGTTTTTTCGGCAAGAACTTGAATAGATGAGTCACTATTGACAGTTACAATACCGCTACTGACGAAATACTTTT TTACATTCCCGTCATTTTCAGTGACTGCAACAATACCAGGCTTCAGACAACCCACTGTGGGGACATGTTCAGGCAAAACA CCAAAACGACCATTTAAAGTGGGGACGTCAACTTGCTTTACGGCGACATTGTTGTAAAAAGCTTGGCCTGATGAAGCGAA AGTAAGCTTGAGTTCCGTCAAACACTGTGTCGAAGTTTGAATACTCCGTAGTTGACTTGGAAGTCGAAAAATGGCAACCT TTTCTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1172: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4191971128048N21915SMNHADA020001SKSmAW
12098582330147AA559451MC260441.NA3TBRI-Saber-cercaria-A
12098872330176AA559480MC260487.NA3TBRI-Saber-cercaria-A
12099772330266AA559570MC070575.NA3TBRI-Saber-cercaria-A


Date: 14:32:8 on Sun 19 Nov 117.