CShisMan2_1173


Sequence

>CShisMan2_1173 (4 EST) Length=341 CATTGTATGTATGTTTATTGAGATAACACAACTGCGTNTTATACATGAACTACTTGTTTTATCACTTTCTCAGTACAACA CATTTAGTCATGCAATTTATGTTCATCATAGGTATCCACGTGCTCGCTTACTTTGCATACTTCACGTATACAATCTCTAA CTCCATCTTGGCAATTTCTTTTACACGCATTGTTTCTACAGTCATTCTTACACTTTATTCCTGTTTCCCAACATTGTGCG CTGCACTTGACTCGGCCAGGTTTGGNTTCGCTGTAAAATCCACAGTATATCACCAACAGAAAGAAAATGAAGTAGAGCTT CATAATGAACAGTTATNTCCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1173: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12098162330105AA559409MC250421.NA3TBRI-Saber-cercaria-A
12099322330221AA559525MC070513.NA3TBRI-Saber-cercaria-A
12099882330277AA559581MC080507.NA3TBRI-Saber-cercaria-A
17371193190039AA999484MCCE3359.M1FSchistosoma mansoni, cercariae


Date: 19:13:43 on Fri 24 Nov 117.