CShisMan2_1184


Sequence

>CShisMan2_1184 (2 EST) Length=368 CAGTTAGCCGCGGAAAGTTTAATAGTCGGTCATTAGAGGCGTGGTATCCAGTCCTTGACAAGAAATGACGAAGGGAACAA CTTCTTTTGGTAACGGCACAACAAATCCCACACTCAGTGCCGTCGTTGTGGTCGCAAATCATACCACATTCAAAAGAAAA CCTGTTCATCCTGTGGATATCCTTCTGCTAGATTAAGGAAATACAACTGGTCTGAGAGAGCTAAACGGCGAGAACAACAG GAACGGGTACGGAATGAGTGAACCTCAAGAGGGTTCATAGACGCTTCAAGCAAGGCTTCCGTTCTGGACCACCAAAACCC GTTAAAAGCATAATGTATTAATATCAGNTAATAANTGATCTGAACGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1184: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4411221162892N21730SMNHADA016008T3SmAW
5858741377933U58055SMU58055Schistosoma mansoni adult worm Lambda ZAP II library


Date: 22:23:31 on Sat 18 Nov 117.