CShisMan2_1185


Sequence

>CShisMan2_1185 (4 EST) Length=332 ATCAGAGAAGCACTTTACTACCAGGTTCAATTATGTACAGAAAAATAGGGNTTTTATAGTAATTAAAGACCTTGAGATAC CATAGTACAGTATGTTAACAGCCATCAGGACCTTGTTATTTTAGTAGACTTTTAGTAGCATAGCTTCTAACTAATCGCTG ATTGGTTGGTCTCTTTATGAGCCTCTCTAGAGTTTATCGTAAGCCGACCTAACACCTTCCTTTTTTTGAAGATTCGAAGA TTAGATTTCCCGGAATTTTTTAAAAAAATTATCTGTAGGTTGAAATTCTCCAACATTTCCTCCCCCAAGAAATTAATGTT GGATCTTCATAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1185: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
3879711065985H85671EST000418S. mansoni cDNA
15130322854312AA791357SMTBADA000851SKSchistosoma Lambda Zap II
15259492873406AA804158SMTBADA000951SKSchistosoma Lambda Zap II
17369323189852AA999297MCCE3109.M1FSchistosoma mansoni, cercariae


Date: 11:32:50 on Wed 22 Nov 117.