CShisMan2_1187


Sequence

>CShisMan2_1187 (6 EST) Length=320 TCTAGCAATGATGAATTTTTATCAATCCTTAATCTGTACTGCTGGTCACAGTGGGTTCGTACCCCAACAAGGGGTGATAA TACACTTGATCTAATATTTGGTAGAGATACCATTCCCCTATCTGTACAAGTATACAACGAGTTTGAAAGCAGTGATCATA GGATAGTAGCTTGTGCTCTCCCCATCTATCCCTCCTACAACCGACCAATTCAAAGAACCTGCAATTATAGAGACTATAAG CATACAGACTGGGACCTCTTGCGCTCACTGATCCANCCGTCACTCCTAAACAAAAGGGCGGAATAATGTAACNTTATTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CShisMan2_1187: (6 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344423972824L46956SCMRAP043C2/tcz2 adult worm mini-library
344428972829L46961SCMRAP048C2/tcz2 adult worm mini-library
344439972840L46972SCMRAP059C2/tcz2 adult worm mini-library
344456972857L46989SCMRAP076C2/tcz2 adult worm mini-library
344767974623L47026SCMRAP1133303/TCZ2 adult worm mini-library
344784974640L47043SCMRAP1303303/TCZ2 adult worm mini-library


Date: 14:18:20 on Fri 17 Nov 117.