CShisMan2_1189


Sequence

>CShisMan2_1189 (2 EST) Length=317 GCGAAGTTGAAAATGGTGGAAAGCTTGGGTCTCGTAAAGGAGTTAATCTCCCAGGGGGCCCATGTCGATTTACCTGCAGT ATCAGAGAAAGACAAACAAGATCTTCGTTTTGCAGTCGAGCATAACGTTGACATGGTGTTTGCTTCTTTCATTCGGAATG CTGATGCTGTACACCAGATCCGTCAACTTCTCGGTGATAATGGTGCCTACATTAAGATCATCGCTAAAATCGAAAATCAT GAAGGCGTCCAACGATTCAATGAAAATCCTTGAACGTTGTTTGAATGGAAATTATGGTTGCTCGTGGTTGATCTAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1189: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
60713529743T24140SMEST0338Schistosoma mansoni, adult worm, Gloria Franco
12098952330184AA559488MC270409.NA3TBRI-Saber-cercaria-A


Date: 23:13:32 on Fri 24 Nov 117.