CShisMan2_119


Sequence

>CShisMan2_119 (2 EST) Length=598 CATCACCATATAATAACACAACATTAGTCTTTTCCTATTGTTATAACTATGGTATTGGTTCGATTCTTAACCATTAGTGG TACGTGTAGGTGTAACAGACAGACAGACAGAAAGAAAAAGAATGTTTGTTCTATGGGTTATTAGTAAGCTGATAAGCAAT TGTTTTAATGAAAAAGAGTTGTATCGTATCGTTAGGAAACAAAAAGGATAAACAAATAAAGGATGGATTAGGGTTGAAAT GTATGTTTTTTTTTTAAAAATGTTATACATGTATTCATTATCAATAAATAGACACACAGAGAGAGATGGATACTTAAAGA GCATAGAGGATCAAACAATTTAAATCATTCATTGAATCAATATCATTAATTAGTTATCATGTACAACAGAACATTATAAA GGATTGAATACACTTTTTTTATTAACCATAGTTACTATTGTTATTCAATGATTAAAACACAATCATTTGGCACTGTTATA TATATTTCATTTGGACATTGAGATGAATGATTTTGAAAGGAAATAATTAAGGACAAATGAATGAATGGATGAGGTACAAA AACTAGACAAATTAAGATATACATCAGATGATGTAAGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_119: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18158273386187AI068220EST209911Schistosoma mansoni, Phil LoVerde/Joe Merrick
18159513386311AI068344EST210035Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 14:30:3 on Sat 18 Nov 117.