CShisMan2_1191


Sequence

>CShisMan2_1191 (3 EST) Length=400 CTCAAACACATTAACCACAACCAANCTCTCATTCACTCTGNACTATTCCCTGCTCAACTCATAGTTCATCCAATATCGAA CTAAACACAGTCATAACAACATAATCAAAGGTCAGTGAAAAGACCGAACACAATAGAGAGGCAGACAATTTCCATTGATA AATAATTCTGGCAGTAACAATTCAATCAACACGCAGTTATCGAAAAGCCAGTCGTAGAAGAAATATGGTTTCGTGTTCTG AAAAATATGCCNACAAACAGCATATTGTCGCTGATCGTCTACGATTGACTTCAAGTTCCATTGGGACGTGCATTGTTTAG GCGAATTCATGGGTTCAATTATTTTGATGATCTTTGGTAGTGGTATATTGGCACAAGTGATCCTAGGTGACCATGGTAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1191: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8733141858026AA233974SMIPADA000047M13RSchistosoma mansoni adult worm Lambda ZAP II library
8733281858040AA233970SMIPADA000061M13RSchistosoma mansoni adult worm Lambda ZAP II library
12100912330380AA559684MC180937.NA3TBRI-Saber-cercaria-A


Date: 6:32:0 on Thu 23 Nov 117.