CShisMan2_1192


Sequence

>CShisMan2_1192 (2 EST) Length=319 CGTTAAGATATTTATGGAAACAATAATAACAAGGAACAGTCTATGAAAATAACGCGATCAGAAAAAAAGATCCAGTGGTG ATGACAGTTATTAATATGAGAGCAACAAGACAAGAAAGAAATCATTCGGTCCATAAAATAGGTGCCACAAAAAAAACGGT GTTCCAGTTCATTATTTACCTTAGTGTTTGAGGNGTGACAAACACAATAGCATAGACCAAAGCAACACAACAGAAANTCG GTCAAAATAAGGGGATANTGACAAANCGTGAGATTTTGAGTGTTTACTCCNATGTATTCATGAGCANGTGAGTGTTATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1192: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39362514756T14589SMEST0250Schistosoma mansoni, adult worm, Gloria Franco
39401514795T14628SMEST0289Schistosoma mansoni, adult worm, Gloria Franco


Date: 9:24:27 on Sun 19 Nov 117.