CShisMan2_1193


Sequence

>CShisMan2_1193 (4 EST) Length=387 CTCGTGCCGCACGNGCAGATTTCTAAAATAAACAATGAGAACAGTTATATGGTTATCTCTTGTAGTGTTTACATTGTATT ATGTAGTCAATATAGAAGCTAATCGAAAAGTTATCTACCGAGGTGCTCAGTCATATGCTGGCTACAAAGGGGATCAAAAC ATTCAAAGAAGGCCACCTACTTCTCGCCGTGTTGATATAAGCAATGTTCCATTGCATGGTGCTCGAAGAAATGATCCAAC TTATCGTCAAGGATTAGAAGAACTAGCTGGGTTAATGTAAAATGAAAGGTTCAAGACAAAAAGCTTATTCATNCAACAAT ACTTTATAATATTTCAAGTTTGCATCCCATAACATATTTTCTTAATTAATACAATAATTATATATAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CShisMan2_1193: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4192221128073N21940SMNHADA020052SKSmAW
11529002245735AA508295MAAD0484.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
12097832330072AA559376MC260302.NA3TBRI-Saber-cercaria-A
17370713189991AA999436MCCE3293.M1FSchistosoma mansoni, cercariae


Date: 23:50:25 on Sat 18 Nov 117.