CShisMan2_1197


Sequence

>CShisMan2_1197 (3 EST) Length=328 AGCTTTTGAGGATGATGCCAGTTACCTTATTCAATGCGGTCCTCANACCCACACTTATGAATGTCATGAAAACTTCAACT GTCAAACTCTCTCCTGCAGCTGTTTCCTGTATTTTCCCCACNAGCCAATTCCATACATCTTCTATCCGAAAAGATATTGA TCAAGCGGCCAAATACATTGGTGCTGGTGCGGCTACTGTTGGATGTGCTGGATCAGGTGCTGGTATTGGGTCTGTATTTG GAAGTTTGACTTTGGGCATACGCCAGGAATCCTGGCCTAAAACAGCAACTGTTTACCTACGCTATCCTTGGTTTCGCTCT GAGTGAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1197: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12098462330135AA559439MC260422.NA3TBRI-Saber-cercaria-A
12101402330429AA559733MC041009.NA3TBRI-Saber-cercaria-A
12101412330430AA559734MC041010.NA3TBRI-Saber-cercaria-A


Date: 8:51:54 on Fri 24 Nov 117.