CShisMan2_1201


Sequence

>CShisMan2_1201 (2 EST) Length=315 CGAGTGAAACAGTTGAAAAAAAAATAAGAGACAAGACAATCCTAATAAATTAATTAATCAGGGATAGATAGATGTATAAT ATACATTAAATATTCAATCATTTGCTGTCAAAAGTGTATCCCATTCATTCAATCATTTGAGAATAGATCAGTTTTATTTA ATATAATTAAAACAAATAGTTTGTTTCTTTATTTTTCTTTTTGTTTTCGCGGTTTTCAAATTTATTTTTTAATTGTATAA TTATTAAATCTAAGTACATAATAATAATATCATTATTATTATTGTATATCTTTAATGATTCGATTGAAATATTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1201: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12165662338815AA566183MA3MR055.AA3S. mansoni adult Lambda Zap
12165832338832AA566200MA3MR072.AA3S. mansoni adult Lambda Zap


Date: 4:18:56 on Fri 24 Nov 117.