CShisMan2_1205


Sequence

>CShisMan2_1205 (2 EST) Length=326 TACAGTGTGATGNAGACCAGGTACTACCGTTTTGCGAAGTGTTTTTCCCTTCGCAAATTCAACAATTGTTTCCTCATCAC TGATTCTATGTTTCGTTTGGGTTTGCATAATTTCTAACATGATTTTTATTATAACACGTATTCAACTATCCTAATACTTG TTACATTTGCATGTGCTTGTTAATCATTGGTGTCCNGTTGCAGCAGAAAATTGATCTNTGGGATAAACTATGTTGCAAGC ATATATTTATTGTACTATGATGTTTGTAAACAATAACTTTCTATCTACTTACTTATTACTTATGTTCATGCAAACTCTCG TGCCGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1205: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12098592330148AA559452MC260442.NA3TBRI-Saber-cercaria-A
12099622330251AA559555MC070557.NA3TBRI-Saber-cercaria-A


Date: 12:39:46 on Tue 21 Nov 117.