CShisMan2_121


Sequence

>CShisMan2_121 (4 EST) Length=597 GCACGAGGACGATGTCACTGTTCGAGTCTTATGAGAAACAGTATGGAAATCTGACTAGCGACATAACATTTAAGTTAGGA AAAATTCCTCAGTTAAACGGTGGTGAAAGAGCGAAAGAAGTACATGATGTGTCAATACTTTTTGACGAGACGAAGGAGTT AATTGAACAAATGTCTCTGGAAGTCCAGGAAATGCGCTCCGATGTCCGCTCCAAATTCCAAAATCGGCTTGAATGTTATC GAAAAGAATTAGAGAAACTTACGACAGAATTCCGGCGACCGCGGTATGCTGTTCGGCGTCCTGACCGTAAGGATTCATAC GGTTTCGATGACGAGGATAATTTACATGAAGAGGTTTTGTTTGATACAGACATGAGAGCTCAGCTTCTGGGCAACACTGA ACGAATATCTCGGACTACTACCAAATTGGAAGATGGTGTGCGAGTCGCTTTAGAAACAGAAGAAGTAGGTGGTCATATAC TACAGGACTTAAGCGAGCAACGGGAAAAACTTCAAAGAAGTAGAGACAAGCTTCGTCAGGCAGATTCTGATCTGAAAAAG AGCTCCCGAATACTTTCAGTTATGACTCGCAGAATTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CShisMan2_121: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18148993385259AI067292EST208969Schistosoma mansoni, Phil LoVerde/Joe Merrick
18155633385923AI067956EST209645Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157053386065AI068098EST209788Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157603386120AI068153EST209844Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 9:26:51 on Sun 19 Nov 117.